RETURN TO THE COURSES PAGE or RETURN TO T. BUDD'S HOME PAGE
Deoxyribonucleic Acid - DNA
The primary metabolism of a cell (often referred to as the "central dogma") is summarized by the following diagram:

DNA and its replication are fundamental to all living cells.
General characteristics of DNA:
DNA is a polymer of nucleotide bases, i.e. a chain with a backbone of sugar-phosphate with bases attached via the #1 carbon of the deoxy-sugar moiety. Two such chains are combined by base pairing with Adenine-Thymine paired by two hydrogen bonds and Cytosine-Guanine paired by three bonds. The two chains usually form a right handed helix (B-helix) and run in opposite directions (antiparallel).
The sodium salt of duplex DNA at about 90% hydration is 20A wide with one turn of the helix every 34 A and containing 10 base pairs. This, of course, indicates a spacing between base pairs of about 3.4 A. This configuration is referred to as the B configuration or structure of DNA. In physiological solution (complete hydration) the B-structure changes such that there are 10.4 base pairs per turn of the helix.
There are other configurations known for duplex DNA, dependent upon parameters such as degree of hydration, base sequence, etc. The A-structure is a right handed helix with 11 base pairs per turn, while the C-structure contains 9.3. A left handed helix has been described for the crystalline structure of the DNA sequence:
d(CpGpCpGpCpG)
This configuration has been designated Z-structure or Z-DNA. This configuration has been known to exist in vivo, demonstrating the flexibility of the secondary structure of the helix. In vivo, DNA probably exists mostly in the B-form, at least when in a "relaxed" state.
Transition between A and B forms of DNA is largely dependent on sequence. Long segments with one strand being purine rich with the complementary strand being pyrimidine rich favors mixed A & B forms. Transition from B to Z form is a result of methylation of cytosine. In this instance the methyl groups extend into the aqueous environment of the major groove. If several cytosines occur adjacently, these methyl groups will tend to aggregate and distort the helix configuration thus forming the Z form.
It is important to note that due to specific base pairing, i.e. A=T and C=G, that the quantitation of bases necessitates that the amount of adenine equals the amount of thymine. The same holds true for cytosine and quanine. The A=T to G=C ratio may differ between species and may be used in certain instances as an indication of phylogenetic relatedness. It stands to reason that the more closely related two organisms are (evolutionarily) the more similar will be their A=T:G=C ratios.
Determination of % G/C.
1. Melting Profile
2. Equilibrium Density Gradient Cent
3. Combination-partially heat A=T split. Then cent. G=C drops
A&T don't
4. Marker Dye
1. Melting Profile - Heating causes a characteristic increase in OD260nm of DNA due to the unraveling of the db strands.
Tm (midpoint melting temp.) - temp at which 1/2 of the DNA is separated. (or 1/2 total OD increase)
Tm value is dependent upon %G=C
Compare Tm of sample to known %GC DNA.
2. Equilibrium Density Gradient Cent. - CsCl - 100000 g's for 20-40 hrs. forms own gradient. Apply and spin DNA. DNA will "seek out" and band at a density level equal to its own. Compare to DNA's of known % GC. The greater the % GC the greater the buoyant density.
3. Combination of 1&2. Heat DNA so only A-T portion separates - cool quickly and "shear" briefly - centrifuge in a density gradient to separate A-T from G-C regions. Measure.
4. Marker Dye - Ethidium Bromide Dye - intercalating dye - i.e. it lodges between base pairs of the polynucleotide chains. (More than 3.4A apart). Forms a colored band in the density gradient tube as a marker of DNA. Some mitochondrial and Polyoma virus DNA does not allow Ethid. Br. to intercalate well - Super Helix-unravel - OK will Bind.
Ethidium bromide
Hypochromism - a decrease in the molar extinction
coefficient of DNA. DNA has an EF of about 40% of the predicted
value. (from physical and analytical procedures) this effect arises
from the interaction of electrons of paired bases stacked in parallel
array. Separation cancels or prevents this interaction. Thus upon
separation of strands of DNA (due to heat for example) an increase
in UV absorbande should be observed.
- may be due to electron interaction between bases in stack.
DNA is genetic material-found in most living
cells at maturity
-Genes are on chromosomes (don't be paranoid about defining a
gene)
-Chromosome structure varies.
Bact. chromosome = db st circular DNA+basic & acidic proteins
Procaryotic DNA is found to be complexed in vivo with basic histone-like proteins, giving a beaded like appearance. The proteins are called DNA binding proteins (or HLPs).
E. coli DNA binding proteins:
|
|
|
|
|
|
|
|
|
40,000 dimers | Histone H2b, H1 | hupA & hupB |
|
|
|
30,000 dimers | Histone H2a | ?? |
|
|
|
?? | ?? | himA & himD |
|
|
|
10,000 | ?? | ?? |
|
|
|
20,000 | ?? | firA |
|
|
|
?? | protamines | ?? |
HU (DNA binding protein II) is made up of a heterodimer of 9.5kd subunits with about 100000copies per cell. The dimer contains a pair of arginine-rich arms that interact (wrap around) with a phosphate of the DNA sugar-phosphate back bone. Thus they are basic proteins and they are fairly thermostable. The dimers bind every 9 base pairs. They also have binding affinity with nicked or gapped DNA. Subunit a is coded by hupA while subunit b is coded by hupB. Both subunits show homology with eucaryotic histones H1 and H2b. They are involved with base excission repair (BER) and work cooperatively with topoisomerase I to produce negative supercoils.
One DNA BP-I + 4-6 DNA BP-II per 200 base pairs (bp). The association of these binding proteins determines the degree of supercoiling.
IHF, Integration Host Factor, was first found as an accesory protein for l DNA
recombination into the E.coli genome. Other roles = transposition,
replication, DNA folding and gene regulation. IHF is a heterodimer:
a - himA ---> 35 kd
b - himD (old = hip) ---> 65 kd
Both subunits are basic proteins, thermostable and have homology
with HU. The dimer can bind non-specifically or sequence specifically
at the ihf site:
-WATCAANNNNTTR- (W=A or T, R=A or G, N= any)
An AT-rich region 5' to this sequence is also involved. The arm of HimA protein binds with the minor grove with the WATCAA sequence while the flank of HimB protein (b ribbons 1 & 2) binds with the TTR sequence or with a major grove. The ihf site is usually in an A-T rich region (which suggests ease of denaturation, i.e., config change) and binding can bend the DNA up to 140o.
HLP-1 (DNA B.P. I) =17kd, 20,000/cell.
There are usuall many other acidic proteins associated with microbial DNA involved in primary metabolism, e.g., enzymes, etc.
As comparison, Pt + Animals - Chromosome is
composed of chromatin. Chromatin = DNA-RNA-histones-proteins (acidic)
Histones - Basic in characteristic due to basic side chains of
certain AA (few ring containing AA, eg. His., Lys., Arg.- all
basic). All this later.
Base sequences are of four general classes (in both pro & eucaryotes).
1. Highly repetitive - may be 2-10 base pairs long repeated 105-107
times in tandem. This type of sequence may make up 1-50 percent
of the total genome, depending upon the species. Much of it occurs
as satelite DNA and is probably not transcribed. It may have some
role in meiosis in eucaryotes.
2. Moderately repetitive - often found in tandem but may also be distributed throughout the genome. The genes for ribosomal RNA (rRNA) and histones are of this class and are repeated about 600 times in each case in man. This class is often found as satelite DNA.
3. Unique sequences - few or single copies of genes for proteins of all types - makes up about 65% of the human genome. Usually interspersed with moderately repetitive sequences.
4. Inverted repetitive sequences - forms hairpin loops by folding back upon itself. These form most rapidly upon renaturation after thermal denaturation thus are easily isolated. These sequences vary in length up to more than 1200 base pairs in man, Drosophila and Xenopus and makes up about 6 percent of the human genome.
Synthesis of the deoxynucleotide triphosphate pool
Nucleosides must be reduced to the deoxyribose form before incorporation into DNA. The reaction is driven by the enzyme ribonucleoside reductase. The reducing power is due to a pair of sulfhydral groups, which after oxidation are reduced again by either a thiol-coenzyme (thioredoxin), glutathione, or cobamide (vt B12 derivative). In vitro, a number of reducing agents can restore ribonucleoside reductase to the reduced form. These include lipoate and tetrahydrofolic acid.
Ribonucleoside reductase of E.coli is composed of two major subunits - R1 and R2 (old = B1 & B2 for bact., M1 & M2 for mammalian).
R1 is composed to two identical peptide subunits (homodimer) called a subunits (nrdA, 85.7 kd ea), each having a pair of sulfhydral groups at the active site for substrate binding. Each has another "effector" binding site which confers substrate specificity (i.e. which nucleoside will be bound at the substrate binding site).
R2 is composed of two identical b subunits (nrdB, 43.4 kd ea) each having a pair of non-Heme iron atoms bridged by an oxygen atom as well as an organic free radicle in a position such that when R1 and R2 join, they become an integral and necessary part of the substrate binding site.
Thioredoxin is a 12 k dal. peptide (heat stable) with two sulfhydryl groups of 2 cysteines used for the reduction. After the cysteines are oxidized to cystine, they are reduced in a reaction using NADPH + H as the electron doner.

DNA Replication - Microbial
The synthetic reaction:

GENERAL CONCEPTS:
Templates of ss DNA are required as is a primer giving a 3'-OH terminus to add bases to. Thus synthesis is in a 5'to 3' direction. The concept of template - primer should be clearly understood. The template is a single stranded region of DNA that will designate, due to the base pairing requirements, the sequence of added bases. The primer provides the 3'-OH end to which new bases are added.
Primer chain growth
5'----------/\/\/\/\/\/\/\/\/\/\/\/\/\/\->
3'--------------------------------------->
DNA template
There are three well characterized polymerase enzymes in microbes such as E. coli. - Polymerase I, II & III
DNA Polymerase I -
MW = 109,000 in E. coli, 112,000 in T4 phage
Single peptide chain = 65 A in diameter - eleptical shape.
non-membrane bound = 400 molecules per E.coli cell.
was thought of initially as replicating enzyme. Various mutants
have shown otherwise.
The first mutant, reported in 1969 was called pol A and was almost devoid of DNA polymerase I activity. There are now several different pol A mutants designated pol A1 (the original) pol A2, pol A3, etc. each having unique characteristics. Pol A is now the gene designation for DNA polymerase I (poly I or Pol I). Pol A1 mutants were found to have other polymerizing enzymes (later)
The pol A1 mutants show a variety of metabolic defects indicating a multiple role of poly I. The most significant defect is an inability to repair UV damage to the DNA. Others include poor replication of plasmid and viral DNA, sensitivity to X-rays and mutagenic chemicals, increased frequency of mutations.
The temperature sensitive mutant pol A12 clearly showed that polA was the gene for poly I. At the "permissive temperature", poly I is synthesized and DNA repair activity is not impaired. At the non-permissive temperature, pol I is not synthesized and DNA repair is impaired.
Most pol A mutants are not completely lacking pol I. The Pol I activity is very low but can be demonstrated as being active in excision-repair and there is some evidence that it participates in the semiconservative replication of the chromosome. Thus, we can not assign pol I as only a repair enzyme and can not rule out a facultative role in replication.
The enzyme catalyzes 3 different reactions, 2 degredative and 1 synthetic.
Nucleolytic reactions:
1. Exonuclease II, 3' ---> 5' direction yielding 5' mononucleotides.
Prefers single stranded (ss) DNA.
2. Exonuclease 5' ---> 3' direction. Attacks double stranded
DNA.
Synthetic reactions:
Synthesis is in the 5' ---> 3' direction on template chain.
Can not bind to double stranded DNA, must "nick" it first. One ss break is enough to allow binding.
Can bind equally well with 3 PO4-5 OH or 3 OH-5 PO4
With ss DNA, many enzyme molecules may be bound.
After binding - must initiate nucleotide incorporation.
Nucleotides are incorporated (PO4 diester bond formed) only if a 3 -OH is present. Pol I can not initiate new chains and thus requires a "primer" as well as a template.
The 5'to 3' Exonuclease activity can be dissociated from the enzyme by mild protease activity. When this digestion is carried out in the presence of DNA, both activities (polymerase synthesis and 5'to 3' exonuclease) are recovered.
The polymerase is associated with a 75,000 MW fragment (Klenow fragment) and the 5'to 3' exonuclease is in a 35,000 MW fragment.
For both, the activity of the fragment is greater on a equi-molar basis than the activities for the intact enzyme.
On a ss template with primer, the polymerase fragment can synthesize DNA. Thus, 5'to 3' exonuclease isn't needed for this activity.
Some workers claim isolation of polymerase enzymes in th 10-20 thousand MW and 40-50 thousand MW class. Not confirmed. It has been shown that the homogenates from which these polymerases were isolated had sufficient proteolytic activity to cleave portions of the total enzyme. Probably cleaved off nucleases.
Apart from a possible (inconclusive) role in replication, many now feel that the primary role for DNA Polymerase I is repair-synthesis. The enzyme can repair gapped and damaged DNA in vivo and in vitro. It also has facultative roles such as Okazaki fragment union and gene rearrangements in conjunction with transposons.
Other properties advantageous to a repair role
are:
1. 5'to 3' nuclease activity which can also remove TT.
2. 5'to 3' nuclease activity can preceed polymerase activity which
replaces correct bases - called "nick translation".
(These two enzyme activities fulfill two postulated steps in UV
repair.)
3. Pol I acts in concert with a DNA ligase enzyme to close chain.
DNA Polymerase I can not completely repair
a chain in E. coli.
The last phosphodiester bond is formed by another enzyme (DNA
Ligase - later).
Kornberg proposes 4 active binding sites for
the polymerase activity:
1. a single site for binding dNTP
2. a binding site for primer (needing 3 -OH)
3. a binding site for primer terminus, i.e. the 3 -OH
4. a binding site for the template
One 20A cleft (synthetic site) and a pocket
(exo) observed.
Can reverse the polymerase reaction by adding lots of PPi.
Using (in vitro) Mn++ in place of Mg ++, Pol I can incorporate rCTP by mistake.
In vitro without template:
dATP + dTTP + Mg++ + Pol I + 2 hr ----> Poly dAT
dCTP + dGTP + Mg++ + Pol I + 2 hr ----> Poly dCG
Commercial templates not so hot. Usually have DNAase II activity yielding 3 NMP's. (Salmon sperm or Calf Thymus).
Summary
Other mutants show:
1. Pol I has a facultative role in repair of DNA. Dimer excising
exonuclease has only been demonstrated in vitro, not in vivo.
This may be due the efficiency of contaminating exo and endonuclease
enzymes in excission of TT.
2. Possible facultative role of Pol I in replication (certain in vitro). Needed apparently in Col E1 mutant but clarification needed. Probably deficient in Pol II.
DNA Polymerase II (poly II or pol II) - E. coli.
The isolation of mutants deficient in pol 1 led to the discovery of two additional polymerizing enzymes designated as DNA Polymerase II and III. These enzymes also appear in wild type cells. Knowledge of their existence led to the isolation of various mutants for these genes. The gene for pol II is designated as polB and pol III as polC.
PolB mutants are deficient in pol II. PolA, polB mutants are deficient in poly I and II. They are still able to replicate due to normal levels of pol III. The polA, polB mutant is not temperature sensitive. PolB cells are not sensitive to UV damage but in polA, polC mutants poly II can be demonstrated to carry on repair type activity.
Poly II has similar synthetic activity as poly I, but has only one exonuclease activity on ssDNA in the 3'to 5' direction - No 5'to 3' exonuclease.
Poly II requires a template, Mg++, 4dNTP
Is susceptible to SH inhibition.
Is not inhibited by or susceptible to DNA polymerase I antibody.
Not stimulated by ATP.
Does not use poly (dA-dT) as template in vitro.
Not very active with "nicked" DNA (in vitro), denatured
DNA OK.
Accounts for 5-10% of Polymerase activity in PolA mutant cells.
Accounts for 20% of Polymerase activity in toluene treated cells.
So far indicated:
1. Repair, acts at nicks (in vivo) does not initiate new strands
(needs template-primer), needs 3'-OH, adds to primer in (synthesis
in) 5'to 3' direction.
2. Approximately 1/500 specific activity of Poly I in wild cells.
DNA Polymerase III (pol III) of E. coli
pol III in pure form is active in polymerase activity in vitro but in vivo it is part of a complex holoenzyme (HE). That is, it is part of a complex aggregate of proteins (quaternary structure) which act together to accomplish replication.
Alone, in vitro - pol III has polymerase activity
and both exonuclease activities, i.e. 3'to 5' and 5'to 3'
Many polC mutants are thermosensitive and the enzyme is thought
to be essential for replication.
Initially, a fraction was isolated with polymerase activity which was distinct from pol III activity and was called pol III* - copol III* complex. We now know that this is actually pol III holoenzyme with the copolymerase III* as one of the other necessary proteins of the holoenzyme.
Pol III prefers gapped DNA with a 3'-OH terminus on the primer end. Pol III has a lower in vitro pH optimum, is inhibited by high salt concentrations and exhibits some repair type activity in vitro
Have reviewed Poly I, II, III.
Study metabolic processes by mutants, inhibitors, and isolation-assays. Microbes first - easier to isolate mutant cells for study - How? Thermosensitive and cryosensitive. Permissive and nonpermissive temps. BAB
Many specific functions are essential for chromosome replication. Some mutants demonstrate required functions for initiation and termination and thus do not cease DNA synthesis immediately upon changing to the nonpermissive temperature. Other functions are necessary for chain elongation and (mutant) DNA synthesis does cease upon the shift to the nonpermissive temp.
The mutant (genetics) and inhibitor studies indicate a minimum of 13 functions needed for initiation and elongation of E. coli DNA replication.
The precise sequence of the mechanism of initiation and elongation varies experimentally according to the type of study; i.e. in vivo vs in vitro, ssDNA vs dbstDNA, nicked vs gapped DNA, etc.
Simplest model is single stranded DNA (ssDNA)
Most such studies are done using Poly I. Binding proteins - necessary for initiation and elongation functions seem to include:
1. stabilizing DNA in a proper configuration
for primer synthesis
2. melting small duplex regions of the DNA that would otherwise
block elongation
3. affecting the activities of other replication proteins by protein-protein
interaction.
Mutant studies indicate that several of the
DNA binding proteins may be active in initiating synthesis. Their
conclusive role in DNA replication has not been confirmed. Priming
of the DNA at the origin is necessary. This is a complicated area
of study. In E. coli there are three enzymatic possibilities for
the de novo synthesis of the primer of ssDNA. (i.e. denatured
or phage DNA)
1. RNA Polymerase (RNAP)
2. dnaG protein
3. dnaG protein - after a prepriming reaction
involving dnaB and dnaC(D), DNA binding proteins and two
or three other proteins.
Once the primer has been added, initiation
of synthesis may occur. Synthesis of ssDNA in vitro may be accomplished
by:
1. DNA Polymerase I
2. DNA Polymerase II only if the DNA is covered with DNA binding
proteins.
3. DNA Polymerase III only in the presence of DNA binding proteins
and several other specific factors.
In vivo, DNA Polymerase III holoenzyme complex (HE) is essential for replication and is a product of several genes. It is ideal as a replicating enzyme in that it has both exonuclease activities and prefers gapped db st DNA. It is inactive with primed long ss DNA. The 3'to 5' exonuclease activity hydrolyzes ssDNA only and yields 5' mononucleotides. The 5'to 3' exonuclease required 5' ss terminus but can continue hydrolysing into a dbst region. E. coli poly III a chain is 130,000 MW and additional subunits (and their genes) have also been found (later).
DNA Polymerase III subunits of E. coli.
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| Synonym |
|
|
|
|||||||
|
|
|
|
||||||||
|
|
|
3'->5' Exo |
|
|
|
|||||
|
|
|
Replication may be divided into three steps:
1. initiation, 2. elongation, and 3. termination.
INITIATION sequence:
The initiation process begins at the origin, in E. Coli called oriC. This process creates bi-directional replication forks that travel in opposite directions and meet at a termination region, Ter.
The origin region of E. coli:

oriC is about 245 bp long, it has four copies of a consensus sequence:
-5' TTATC/ACAC/AA 3'-
as two inverted repeats. These are designated R1-R4, bind dnaA protein and thus are referred to as the dnaA box.
Left (5') of the dnaA box are three A+T 13mers (L,M, & R-13mer) which are easily denatured for initiation.
Fis and IHF are the binding sites for small
DNA binding proteins.
oriC also contains 11 copies of the sequence -5' GATC 3'-, 8 of
whos positions are highly conserved. These are sites for "Dam"
methylases. The methylation of these sites controll the attachment
of oriC to the cell membrane.
dnaA protein molecules bind to the four dnaA boxes only when complexed with ATP (dnaA-ATP complex) and only in the presence of DNA binding protein HU. (other DNA binding proteins can be active in vitro as well, in vivo -?) DnaA protein is a weak ATPase, using this energy to denature the A+T rich R1-R4 in sequence from right to left. This sequence of melting may also be influenced by superhelicity which seems to be required for this function. The presence of dnaA proteins allow the binding of dnaB protein of a dnaB-dnaC protein complex (in solution) to a site between the denatured (ssDNA) chains yielding a prepriming complex. These prepriming complexes are often referred to as specialized nucleoprotein structures or snups. The ssDNA chains are presumably stabilized with SSBs.
The dnaB protein is a helicase (52 kd hexamer) and is capable of binding a priming enzyme (dnaG protein) thus forming a complex called a primosome.
So far, only a single stranded region has been created. The next step in intiation at oriC involves the transcription of 2 orfs.:
1. mioC - to the right of oriC and
2. gidA - left of oriC.
Both orfs have promotor sequences within oriC and thus both transcripts are systhesized by RNAP. The transcripts (RNA) act as the initial primer for DNA synthesis on the leading strand for each fork (bi-directional).
The dnaG protein apparently takes over the primase activity (in the priosome complex) for forming the first and subsequent Okazaki fragments. Once primers are added, HE complex assembly can proceed. The initial synthesis of DNA on the leading strand may explain the ability to isolate pol III' & *.
The ade subunits bind to the stable ssDNA and may even do the initial leading strand synthesis from the "transcript termini". The assembly of the highly processive HE is accomplished with the association of the gd complex. This complex is made up of g2dd'cy, allows the dimerization of the synthetic proteins and the ATPase dependent binding of the b protein dimer. This dimer is referred to as a sliding clamp as it surounds the helix and greatly increases processivity of the HE complex.
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|


The dnaZ gene product (g protein, formerly called dnaH), combines with d protein (formerly
DNAEF I) to form a complex free of the primed DNA Polymerase III*
and other factors. In the presence of DNA binding proteins (on
the primed DNA) the gd complex will associate with moderate affinity with
the primed template. The association does not require ATP or dATP.
the dnaZ protein - DNA EFIII complex on the primed template then catalyses the transfer of DNA EFI to the primed template. This transfer requires ATP or dATP as a cofactor. The template - DNAEFI complex is then free of dnaZ protein, DNA EF III, Polymerase and ATP.
ELONGATION: (may
apply to db st DNA too)
Pol III holo elongation is fairly processive, no configurational
changes confirmed yet, but, ATP hydrolysis continues during elongation,
probably drives config changes for translocation along the template.
If elongation is stopped by omission of one dNTP, replication stops but holo remains bound to template.
Anti-B subunit antibody does not inhibit elongation, thus B is probably not "exposed".
Synthesis is at a rate of about 1 Okazaki fragment (= 1000 bases) per second, probably in a semi or quasi-processive mode (BAB).
SUBUNITS:
dna ZX gene (orf) codes t (tau) while the g subunit is coded only by the "Z" portion
of the continuous orf; ie. g AA sequence is similar to n-term sequence of t. There is a
"rare" arginine codon (AGA, on the m-RNA) which occurs
at about the right position followed by a hairpin sequence (CUUCGG)(slide),
---> frameshift attempt, ---> premature termination --->
g
subunit.
- U C
U G
C-G
G U
G-C- -CUG-GAA AGA-CU ACCGAU-
- -Leu- Glu---Arg
In support, the gene for the t-RNA having the anti-codon for AGA when mutated, inhibits DNA replication, presumably by deficiency of g.
g , d & d' form a g2dd' complex in vitro (and perhaps in vivo in sol) which is involved in holo reconstitution. Two low molecular weight components have also been found associated with the complex, designated c (chi, 14kd) and Y (psi, 12kd) and provisionally assigned as holoenzyme subunits. Thus complex = g2,d,d',c,Y.
The gd complex (dnaZ protein-DNAEF-III) may or may not dissociate from the primed template after catylizing the attachment of B (DNAEF-I). Pro = high specific activity in initiation; con = it's present in the holoenzyme at termination and during elongation. Suggests perhaps 2 mechanisms in sequence?? Stoichiometry not conclusive.
All of the preceeding is essentially descriptive for ssDNA and dsDNA). All of the proteins mentioned so far function (at least in part) to control the conformation of DNA at the helix level as well as at the superhelix level. Now we must consider the replication of the chromosome as a whole.
TOPOISOMERASES AND HELICASES
There are a variety of other proteins which effect DNA conformation and thus are at least indirectly involved in replication. They are often collectively referred to as topoisomerases and helicases but individual proteins are assigned specific names. These include:
DNA Gyrase (Topo-II) and DNA Swivelase (Topo-I) and unwinding proteins.
If DNA Polymerase III is the replicating enzyme of E. coli, then to perform the above described synthesis, we must unwind the superhelix, the helix and separate strands of the duplex. Note that these activities need only occur at the replication fork areas and at the origin.
DNA Gyrases - cause the relxation of DNA as well as the rewinding into a superhelix. In the presence of ATP it has ATPase activity and causes negative supercoiling of covalently closed circular DNA (i.e. relaxed DNA). In the absence of ATP it does the reverse, i.e. relaxes DNA. In order to operate the enzymes must be able to produce transient scissions in the duplex helix. The enzyme is composed of two subunits - products of genes gyrA (nalA) and gyrB (cou) - both required for E. coli replication. The relaxing activity has been shown to be due to the subunit protein produced by the gyrA gene, and functions like the swevelase enzyme to be discussed later. The enzyme is able to relax negative and positive superhelixes. The ATPase activity appears to be associated with the gyrB gene product. The coiling of the relaxed helix into a negative superhelix (the enzyme can not form positive helixes) requires the complete enzyme (both subunits). Molecular form is A2B2 although T4 phage codes a trimer form with gp52, gp39 & gp60.
Topo - 1 or DNA Swivelase - initially called omega (w) protein, swivelases can only relax negative superhelixes and is unable to recoil the helix. E. coli has 67kd monomer in a ring-like structure with 4 active domains.
The action of both swivelase and gyrase enzymes is to transiently provide a region of relaxed db st. DNA that is then able to undergo strand separations. In order to have strand separation, the helix must swivel; a dynamic process.
Another group of proteins invoved in this process are the helicases. See table.
Helicases of E. coli:
|
|
|
|
|
|
| HELICASE I |
|
|
|
|
| HELICASE II |
|
|
|
|
| HELICASE III |
|
|
|
|
| HELICASE IV |
|
|
|
|
| REP PROTEIN |
|
|
|
|
| DnaB PROTEIN |
|
|
|
|
| n' PROTEIN |
|
|
|
|
| RecBCD enzyme |
|
|
|
|
| Rho Protein |
|
|
|
|
| UvrAB complex |
|
|
|
|
From Matson & Kaiser-Rogers, ARB 59:289.
E. coli DNA unwinding protein - one of the largest single peptides in the cell. 180,000 MW - is monitored through its ATPase activity. It utilizes the energy of the ATPase reactions to unwind and separate strands of either duplex DNA or DNA-RNA hybrids. Must have a ss DNA region to bind and initiate strand separation. It can not act on closed duplex DNA.
E. coli has genes for several other unwinding proteins each one having ATPase or dATPase activity. Some are known to unwind phage or plasmid DNA and thus may not be involved or necessary for E. coli replication. These unwinding proteins include:
E. coli rep protein - these mutants replicate normally except that the replication fork moves more slowly than in wild type cells. NOTE: This may indicate that several molecules of a variety of unwinding proteins are necessary for strand separation at the forks. For example, in vitro, it requires about 2000 base pairs in length. Although this is probably more than required in vivo, there is still a high probability that several molecules are involved with strand separation at the fork.
The rep gene protein probably combines with the cisA gene protein and E. coli HDP, in a weak association for its activity. Like the E. coli DNA unwinding protein, the rep protein can bind only to a ss region thus it can unwind (sep strands) at nicks and gaps.
Helicase (II or III) binds to lagging strand and moves 5'->3' at Fork - ATPase act. Rep. Protein (helicase) binds to leading strand. 3 5 ATPase.
E. coli, recB and recC proteins - these proteins combine and exhibit a variety of nuclease activities - called recBC nuclease formerly called exonuclease V. It has activity on both ss & dbstDNA and can hydrolyse from either the 5' or 3' end. It generates oligonucleotides of about 5 nucleotides long. It has a high ATPase activity which probably drives the nuclease activity. It also acts as an endonuclease and although ATPase accitity isn't required for this function, endonuclease action is stimulated by it. Oddly, E. coli HDP has a protective function when bound to ssDNA, and the recBC nuclease is unable to hydrolyze it. The activity of the nuclease is also affected by the recA gene product.
The precise role of all of the above unwinding proteins remains to be clearified.
Helix destablilizing protein - HDP- also called Single Stranded Binding proteins - SSBs - several phage and E. coli HDPs have been isolated. E.coli HDP is a tetramer of 20,000 + 2000 kd subunits in the functional state. This HDP binds selectively to ssDNA, and prevents helix formation (reannealing), and each tetramer interacts with 30-36 nucleotides. Could play a role in maintaining or creating single strandedness at the origin of synthesis. HDPs are probably one of a group of DNA binding proteins which lend specificity and configuration agreement for the association of replication proteins and transcription proteins.
During the polymerization process, i.e., fork movement, it is not clear whether the polymerase, pol III remains attached after synthesis of each short section of DNA (the length corresponding to the length of the Okazaki fragment) or whether it dissociates from the fork after each condensation. Some systems indicate that the same pol III remains attached and the fork moves steadily to termination - this is called processive. Other studies indicate that pol III dissociates after the addition of the oligodeoxy ribonucleotide and is termed nonprocessive or distributive replication. Other systems have shown a process somewhere in between these two extremes - this is referred to as quasi-processive. The addition of the b sliding clamp makes the hohoenzyme very processive.
The nascent DNA fragments of discontinuous replicative synthesis were discovered by Okazaki and are 1000-2000 nucleotides in length in procaryotes and 100-200 nucleotides in length in eucaryotes. Usually, the number of fragments is small due to the continuous process of joining them together to complete the DNA chain. It was noted that these fragments accumulate when DNA ligase and/or pol I are inhibited thus indicating a critical role of these enzymes in the joining process.
Fidelity is very difficult to measure, but the error rate in vitro is higher than in vivo.
In vitro the error rate is one in several hundred bases per to one in 10-6th bases incorrectly inserted.
In vivo the rate is much lower - in E. coli
it is about 2 in every 10-10th bases inserted, in phage and T4
its about 200 in every 10-10th bases inserted.
Rolling Circle Models, with and without knife and fork.
TERMINATION:
Termination is done at a specific site on the chromosome, TER or ter. There are 5 sites, terA - E, within ter having inverted repeats 22 bp long:
5' - AATAAGTATGTTGTAACTAAAG -3' (called tau seq.)
terB and terC terminate the clockwise fork while terA, D & E terminate the counterclockwise fork. The first nucleotide of the sequence is the arrest point.
Works by inhibiting the dnaB helicase by binding TBP (terminus binding protein) that is coded by the gene tau (tus=old). This protein (36kd, also called a polar contrahelicase) has a proline repeat sequence that gives rise to a "pipe" motif structure where proline and other non-polar residues occurr on one side of the helix while the opposite side has basic and polar residues. This structure can fit into the major groove of B-form of DNA such that the basic amino acid sidechains are positioned near phosphates of the sugar-phosphate backbone. This protien can also block RNA polymerases. Some evidence suggests that these proteins are helicase specific, i.e., not all synthesis forks use the same helicase?